View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9805_low_15 (Length: 212)
Name: NF9805_low_15
Description: NF9805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9805_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 27 - 193
Target Start/End: Complemental strand, 34838429 - 34838263
Alignment:
| Q |
27 |
tgatagaaacactaaaattccagcaacnnnnnnntatagagatattagaatttacttgttgtgttgttgagaaaatgtgacaaaaaagaagtgtaatatg |
126 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34838429 |
tgatagaaacactaaaattccagcaacaaaaaaatatagagatattagaatttacttgttgtgttgttgagaaaatgttacaaaaaagaagtgtaatatg |
34838330 |
T |
|
| Q |
127 |
gtatttctttgtagggaatcaatatttcaacgaagaagtgattttggagagtaaagaaagtgttttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34838329 |
gtatttctttgtagggaatcaatatttcaacgaagaagtgactttggagagtaaagaaagtgttttt |
34838263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 69 - 130
Target Start/End: Original strand, 34219769 - 34219830
Alignment:
| Q |
69 |
tattagaatttacttgttgtgttgttgagaaaatgtgacaaaaaagaagtgtaatatggtat |
130 |
Q |
| |
|
|||||| | ||||||||||||||||||| ||||||| ||||| ||||||| ||| |||||| |
|
|
| T |
34219769 |
tattaggacttacttgttgtgttgttgaagaaatgtggcaaaagagaagtgcaatctggtat |
34219830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University