View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9805_low_8 (Length: 311)
Name: NF9805_low_8
Description: NF9805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9805_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 7 - 310
Target Start/End: Original strand, 37216198 - 37216501
Alignment:
| Q |
7 |
acgtaaaaccatcaaaattttcatatcacaattaaccgataaataagaactactagaagataattgaacccctgttaccttcagccttagatgaatcata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37216198 |
acgtaaaaccatcaaaattttcatatcacaattaaccgataaataagaactactagaagataattgaacccctgttaccttcagccttaggtgaatcata |
37216297 |
T |
 |
| Q |
107 |
aacgactttcaacattttccctctacttctctttaatgttttaaacataacttttatatccttactcgagagtcgcattattttccgtagaccattgaat |
206 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37216298 |
aacgactttcaacatgttccctctacttctctttaatgttttaaacataacttttatatccttactcgagagtcgcattattttccgtagaccattgagt |
37216397 |
T |
 |
| Q |
207 |
ggaattttctcgtgcctaccatgatccttcttggttgtacaaacaccactggactctccttgactacctttcatcgttactgaaccccattaagtctcct |
306 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37216398 |
ggagttttctcgtgcctaccatgatccttcttggttgtacaaacaccaccggactctccttgactacctttcatcgttactgaaccccattaagtctcct |
37216497 |
T |
 |
| Q |
307 |
ttgc |
310 |
Q |
| |
|
|||| |
|
|
| T |
37216498 |
ttgc |
37216501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University