View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9806_high_19 (Length: 239)

Name: NF9806_high_19
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9806_high_19
NF9806_high_19
[»] chr7 (4 HSPs)
chr7 (1-223)||(33399935-33400157)
chr7 (97-222)||(33396946-33397071)
chr7 (97-223)||(33442246-33442372)
chr7 (97-223)||(33452496-33452622)


Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33399935 - 33400157
Alignment:
Q  1 tttatgctggactcttacacttatnnnnnnnntgtaattgatttagtttctcaatatttagcgaagaaattagagatagagaaagaatatgagtagaatg 100  Q
    ||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33399935 tttatgctggactcttacacttataaaaaaaatgtaattgatttagtttctcaatatttagcgaagaaattagagatagagaaagaatatgagtagaatg 33400034  T
Q  101 agcttactgagtgtgtctccgagacgaaagaccttgtttgcagcccaagcttggtaatcaaccccaagtgtccaaccactttcatctccaaccacaaaat 200  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  33400035 aggttactgagtgtgtctccgagacgaaagaccttgtttgcagcccaagcttggtaatcaaccccaagtgtccaaccactttcatctccaactacaaaat 33400134  T
Q  201 cttttgccacagccatggttgag 223  Q
    |||||||||||||||||||||||    
T  33400135 cttttgccacagccatggttgag 33400157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 97 - 222
Target Start/End: Original strand, 33396946 - 33397071
Alignment:
Q  97 aatgagcttactgagtgtgtctccgagacgaaagaccttgtttgcagcccaagcttggtaatcaaccccaagtgtccaaccactttcatctccaaccaca 196  Q
    ||||||||||||||||||||| || | ||||||||| |||||||||||||||  ||| ||||||||||| | | ||||||||| |||||||||||| |||    
T  33396946 aatgagcttactgagtgtgtcccctacacgaaagactttgtttgcagcccaatattgataatcaacccctaatttccaaccacgttcatctccaactaca 33397045  T
Q  197 aaatcttttgccacagccatggttga 222  Q
    ||||||||||||||||||||||||||    
T  33397046 aaatcttttgccacagccatggttga 33397071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 97 - 223
Target Start/End: Original strand, 33442246 - 33442372
Alignment:
Q  97 aatgagcttactgagtgtgtctccgagacgaaagaccttgtttgcagcccaagcttggtaatcaaccccaagt-gtccaaccactttcatctccaaccac 195  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| | ||||| |||||||||||  | |||| ||||||||  ||||||| ||||| ||    
T  33442246 aatgagcttactgagtgtgtccccgagacgaaagaccttgtttgcggtccaagtttggtaatcaa-acaaagtagtccaacccttttcatcaccaactac 33442344  T
Q  196 aaaatcttttgccacagccatggttgag 223  Q
    ||||||||||||||||||||||||||||    
T  33442345 aaaatcttttgccacagccatggttgag 33442372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 97 - 223
Target Start/End: Original strand, 33452496 - 33452622
Alignment:
Q  97 aatgagcttactgagtgtgtctccgagacgaaagaccttgtttgcagcccaagcttggtaatcaaccccaagt-gtccaaccactttcatctccaaccac 195  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| | ||||| |||||||||||  | |||| ||||||||  ||||||||||||| ||    
T  33452496 aatgagcttactgagtgtgtccccgagacgaaagaccttgtttgcggtccaagtttggtaatcaa-acaaagtagtccaacccttttcatctccaactac 33452594  T
Q  196 aaaatcttttgccacagccatggttgag 223  Q
    ||||||||||||||| ||||||||||||    
T  33452595 aaaatcttttgccacggccatggttgag 33452622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University