View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_11 (Length: 304)
Name: NF9806_low_11
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 39795105 - 39795403
Alignment:
| Q |
1 |
aaaaacaacagtatccatgaatgtcgtttgaagatgatcaagtcgtttccacctaaacgcagagaatctccatggccaaatttctttcttcactttcttc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39795105 |
aaaaacaacggtatccatgaatgtcgtttgaagatgatcaagtcgtttccacctaaacgcagagaatctccatggccaaatttctttcttcactttcttc |
39795204 |
T |
|
| Q |
101 |
aaccataacatgctactcttctttcccatcaaacgctttctcaaactactctttctaatatcttttgtttggtcttccatggaatatttggatatatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39795205 |
aaccataacatgctactcttctttcccatcaaacgctttctcaaactactctttctaatatcttttgtttggtcttccatggaatatttggatatatgaa |
39795304 |
T |
|
| Q |
201 |
attgttatgtgaggtagatactcttttataggatt-----------agaatatcaataatgaggtggctttggatgcttcagagacaaggatgttattg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39795305 |
attgttatgtgaggtagatactcttttataggattagattagattaagaatatcaataatgaggtggctttggatgcttcagagacaaggatgttattg |
39795403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 39774145 - 39774204
Alignment:
| Q |
20 |
aatgtcgtttgaagatgatcaagtcgtttccacctaaacgcagagaatctccatggccaaatt |
82 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||| |||||||||||||| ||||||||| |
|
|
| T |
39774145 |
aatgtcgtttgaatatgatcaagtc---tcaacctaaatgcagagaatctccaaggccaaatt |
39774204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 39791415 - 39791463
Alignment:
| Q |
1 |
aaaaacaacagtatccatgaatg-tcgtttgaagatgatcaagtcgttt |
48 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
39791415 |
aaaaacgacagtatccatgaatgattgtttgaagatgatcaagtcgttt |
39791463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University