View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_13 (Length: 278)
Name: NF9806_low_13
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 31041103 - 31041371
Alignment:
| Q |
1 |
aaattcaaaaataaaagtaattatatttttatttttggaaaaccaatcccaaacactcta---acgtggtttgctagttgtaatgcattcgaatagtatt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
31041103 |
aaattcaaaaataaaagtaattatatttttatttttggaaaaccaatcccaaacactctctctacctggtttgctagttgtaatgcattcgaatagtatt |
31041202 |
T |
|
| Q |
98 |
atatgaatcgtctgattaagatcacattgtttagattttaatggtgtcataccttgatttagtggtttgtcttattaagaataaatggttgagatcatgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31041203 |
atatgaatcgtctgattaagatcacattttttagattttaatggtgtcataccttgacttac-ggtttgtcttattaagaataaatggttgagatcatgt |
31041301 |
T |
|
| Q |
198 |
gactgcattaatgcatgattatctcgaccttaaggaattcatttctctccgactccaaaacacctatgct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31041302 |
gactgcattaatgcatgattatctcgaccttaaggaattcatttctctccgactccaaaacacctatgct |
31041371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University