View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_14 (Length: 275)
Name: NF9806_low_14
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 84 - 253
Target Start/End: Complemental strand, 4149710 - 4149541
Alignment:
| Q |
84 |
gagtttataaacgaaatgtataacaatccagttatacatatgctcatgagagctgagtatatagctgataaggtgaatgagtgggagttgaagaagaatg |
183 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4149710 |
gagtttatgaacgaaatgtataacaatccaattatacatatgctcatgagatatgagtatatagctgataaggtgaatgagtgggagttgaagaagaatg |
4149611 |
T |
 |
| Q |
184 |
agaaacctcgtaagcctgaagatagagagctttggaagaaagtgcccaatattattgggcttgatgggag |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4149610 |
agaaacctcgtaagcctgaagatagagagcattggaagaaagtgcctaatattattgggcttgatgggag |
4149541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University