View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_15 (Length: 274)
Name: NF9806_low_15
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 11065980 - 11065725
Alignment:
| Q |
1 |
aacaatcttggacctatatgttttatgtccaagaaagacagtttttacaatatactttttcccctaacttgggtactttaaagtaaaggttatagctata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11065980 |
aacaatcttggacctatatgttttatgtccaagaaagacagtttttacaatatcttttttcccctaacttgggtactttaaagtaaaggttatagctata |
11065881 |
T |
|
| Q |
101 |
tttagtatttaccaatttatttatacatagagattatgtaatcatttagattggttattttgttaaacaatccataaatatccgcnnnnnnnnnnnnnna |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11065880 |
tttagtatttaccaatttatttatacatagagattatgtaatcatttagattggttattttgttaaacaatccataaatatccgctttttaattttttta |
11065781 |
T |
|
| Q |
201 |
gaattcattaaccatattaaacattccctatatatacttaataacattgcttcact |
256 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11065780 |
gaattcattaaccataataaacattccctatatatacttaataacattgcttcact |
11065725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University