View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_16 (Length: 254)
Name: NF9806_low_16
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 23407544 - 23407764
Alignment:
| Q |
17 |
catagggagggtggtggtgaacaaactggttcacctatgtacgattgaagaaagactagggagcatgtggcaatcttggagaaaaattactttaatgtct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23407544 |
catagggagggtggtggtgaacaaactggttcacctatgtacgattgaagaaagactagggagcatgtggcaatcttggagaaaaattactttaatgtct |
23407643 |
T |
 |
| Q |
117 |
atggaggataataagtatatggttcaatttttataa-gtgatcgggagagaatttttcaaggaagtccttgactaattgat-aaaataagattatcttgc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||| |||||| |||||||||||||| |||||| ||| ||||||| |
|
|
| T |
23407644 |
atggaggataataagtatatggttcaattgttataaggtgatctggagagaatttttcatggaagtacttgactaattgataaaaatatgatcatcttgc |
23407743 |
T |
 |
| Q |
215 |
agaacgttgctataggtgaag |
235 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
23407744 |
agaaggttgctataggtgaag |
23407764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University