View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_17 (Length: 254)
Name: NF9806_low_17
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 66 - 238
Target Start/End: Original strand, 39615503 - 39615676
Alignment:
| Q |
66 |
gtcacagtttcagcgtctgttttgtacaggtgaagaaagcgaatgactaggaaaggagaaaggtacagaattttgcaacgtcacggcccagtcaatttat |
165 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39615503 |
gtcacagtttcagcgtgtgttttctacaggtgaagaaagcgaatgaccaggaaaggagaaag-tacagaattttgcaacgtcacggcccagtcaatttat |
39615601 |
T |
|
| Q |
166 |
ttctttttagag--ataggagtgagatacgaaaagggcgagttcatgtgagctcggtggtctagtttgactttaa |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39615602 |
ttctttttagagagataggagtgagatacgaaaagggcgagttcatgtgagctcggtggtctagtttgactttaa |
39615676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 39615470 - 39615510
Alignment:
| Q |
18 |
gagatgacggtggcgacgccattctcagaaaccgtcacagt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39615470 |
gagatgacggtggcgacgccattctcagaaaccgtcacagt |
39615510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University