View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_19 (Length: 252)
Name: NF9806_low_19
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 30314788 - 30315027
Alignment:
| Q |
13 |
cataggtcaacggaatcttaggaggtgacgcacttgccggaggctgagatggtggcacagccgtgacattaggtgtgacattagggcgaacagccatgac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30314788 |
cataggtcaacggaatcttaggaggtgacgcacttgccggaggctgagatggtggcacagccgtgacattaggtgtgacattagggcgaacagccatgac |
30314887 |
T |
 |
| Q |
113 |
ttgaacagtcatcttttcatcatgcttgcagttgtcagcattgccactgatgaaataatagaaacccgagtcactcagcttaaacttggaattaccattg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30314888 |
ttgaacaatcatcttttcatcatgcttgcagttgtcagcattgccactgatgaaataatagaaacccgagtcactcagcttaaacttggaattaccattg |
30314987 |
T |
 |
| Q |
213 |
tccaatttttgttttggattgttggtgttgcaagaatcat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30314988 |
tccaatttttgttttggattgttggtgttgcaagaatcat |
30315027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University