View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_22 (Length: 248)
Name: NF9806_low_22
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 33399748 - 33399512
Alignment:
| Q |
1 |
ataaaattgcattgacaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcataaatgttttgccaaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33399748 |
ataaaattgcattgacaacctatgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcataaatgttttaccaaa |
33399649 |
T |
 |
| Q |
101 |
acaagatggttggtatccagccccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399648 |
acaagatggttggtatccagcaccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
33399549 |
T |
 |
| Q |
201 |
gctgctagcgtgcagacatcagagttaacttggtctc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399548 |
gctgctagcgtgcagacatcagagttaacttggtctc |
33399512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 11 - 237
Target Start/End: Complemental strand, 33395851 - 33395628
Alignment:
| Q |
11 |
attgacaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcataaatgttttgccaaaacaagatggt |
110 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||| ||| |||||||| | ||| ||||||||||||||||| || |||| ||| |||| |
|
|
| T |
33395851 |
attgacaacctatggaagaagatggtacatttcaggtgctgctcatcactgcaatcttggccaaaagcttttcataaacgtgcagccaccacagtttggt |
33395752 |
T |
 |
| Q |
111 |
tggtatccagccccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgggctgctagcg |
210 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||| |||||||||||||||||| | |||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
33395751 |
tggtctccagtaccctc---accttcagcctccccgtcaccctcacctgtgccgactcctgaagcagcaccaccttcaaatgcgccatgggctgctagcg |
33395655 |
T |
 |
| Q |
211 |
tgcagacatcagagttaacttggtctc |
237 |
Q |
| |
|
||||||||||||| |||||| ||||| |
|
|
| T |
33395654 |
tgcagacatcagaaataacttcgtctc |
33395628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 15 - 120
Target Start/End: Complemental strand, 33442050 - 33441945
Alignment:
| Q |
15 |
acaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcataaatgttttgccaaaacaagatggttggt |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33442050 |
acaacctatgggagaagatggtacatttcaagtgttaccgatcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggt |
33441951 |
T |
 |
| Q |
115 |
atccag |
120 |
Q |
| |
|
||||| |
|
|
| T |
33441950 |
ctccag |
33441945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 15 - 120
Target Start/End: Complemental strand, 33452270 - 33452165
Alignment:
| Q |
15 |
acaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcataaatgttttgccaaaacaagatggttggt |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33452270 |
acaacctatgggagaagatggtacatttcaagtgttaccgatcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggt |
33452171 |
T |
 |
| Q |
115 |
atccag |
120 |
Q |
| |
|
||||| |
|
|
| T |
33452170 |
ctccag |
33452165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 144 - 237
Target Start/End: Complemental strand, 33395622 - 33395529
Alignment:
| Q |
144 |
ccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgggctgctagcgtgcagacatcagagttaacttggtctc |
237 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
33395622 |
ccctcaccctcacctacaccggcccatgaagcagcaccgtcttcaaatgcaccatgggctgctggcgcgcagacatcagagataacttggtctc |
33395529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 144 - 237
Target Start/End: Complemental strand, 33399506 - 33399413
Alignment:
| Q |
144 |
ccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgggctgctagcgtgcagacatcagagttaacttggtctc |
237 |
Q |
| |
|
||||| ||||||||| || ||||||||||| ||||| ||||||||||||||||||| ||||||||||||| |||||||| ||| |||||||| |
|
|
| T |
33399506 |
ccctcgccctcacctacaccagcccctgaagccgcacctccttcaaatgcaccatgggttgctagcgtgcaggcatcagagataaattggtctc |
33399413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 200
Target Start/End: Complemental strand, 33399408 - 33399357
Alignment:
| Q |
149 |
accctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
200 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
33399408 |
accctcacctacaccggcccctcaagcagcaccaccttcaaatgcaccatgg |
33399357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 200
Target Start/End: Complemental strand, 33395507 - 33395473
Alignment:
| Q |
166 |
cccctgaagcagcaccgccttcaaatgcaccatgg |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33395507 |
cccctgaagtagcaccgccttcaaatgcaccatgg |
33395473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University