View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_24 (Length: 240)
Name: NF9806_low_24
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 11913540 - 11913323
Alignment:
| Q |
18 |
aatcgaaaagagatctctaatatagtagtctcaaacagaaataagaaattcataggaactatttgtgtcatttcccttgtttgcaatatttaattgcatg |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11913540 |
aatcgaaaagtgatctctaatatagtagtctcaaacagaaataagaaattcataggaactatttgtgtcatttcccttgtttgcaatatt-aattgcatg |
11913442 |
T |
 |
| Q |
118 |
gtgaactacttataatctcttaattgaattttcattatggttgttgtaatacattttgaaataaattgacaagaatttgtttgataaaacaaactccttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11913441 |
gtgaactacttataatctcttaattgcattttcattatggttgttgtaatacattttgaaataaattgacaagaatttgtttgatcaaacaaactccttc |
11913342 |
T |
 |
| Q |
218 |
cattcaagcaacaacgtaa |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11913341 |
cattcaagcaacaacgtaa |
11913323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University