View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9806_low_28 (Length: 221)
Name: NF9806_low_28
Description: NF9806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9806_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 112 - 208
Target Start/End: Complemental strand, 32184003 - 32183904
Alignment:
| Q |
112 |
gttagcttggttcacatacctaataatccaaacatacaaaatataaatcaaccatagtggag---agtaaaaataaatagttagctagctagcttggttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || || ||||| ||||||||| |||||||||||||||| |
|
|
| T |
32184003 |
gttagcttggttcacatacctaataatccaaacatacaaaatataaatcaaccataatgcagaaaagaaaaaaaaaatagttatctagctagcttggttc |
32183904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 32184049 - 32184000
Alignment:
| Q |
18 |
agaaacagtaacacacacgccacctttgagcaccatagattttcaagagtta |
69 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
32184049 |
agaaacagtaacacacac--cacctctgagtaccatagattttcaagagtta |
32184000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University