View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9807_high_14 (Length: 238)
Name: NF9807_high_14
Description: NF9807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9807_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 224
Target Start/End: Complemental strand, 46619214 - 46618997
Alignment:
| Q |
8 |
aagcagagattatacatcaaatctatcacgctggcatagctggctccaatagctaaagacaattacagttacttcttttcttggctacaatttatatcta |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46619214 |
aagcaaagattatacatcaaatctatcacgctggcatagctggctccaatagctaaagacaattacagttacttcttttcttggctacaatttatatcta |
46619115 |
T |
 |
| Q |
108 |
tatccattcaaactcaccacagcataaaccagaactttctacatttttggataaattggaaaaatttgtattgggtactgcatgtcgtgtgcgaac-aat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
46619114 |
tatccattcaaactcaccacagcataaaccagaactttctacatttttggataaattggaaaaatttgtattgggtactgcatgtcatgtgcgaacaaat |
46619015 |
T |
 |
| Q |
207 |
aagttttaggttcgattt |
224 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
46619014 |
aaattttaggttcgattt |
46618997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University