View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9807_high_15 (Length: 235)
Name: NF9807_high_15
Description: NF9807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9807_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 98 - 200
Target Start/End: Complemental strand, 42121494 - 42121392
Alignment:
| Q |
98 |
aatatacaatcttttgtgaatattgactcttctttcagaggttatttggtgtgtctctggctttacctgtttgctatgaaagttcaccaatcaaactgat |
197 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42121494 |
aatatacaatcttttgtgaatattcaatattctttcagaggttatttggtatgtccgtggctttacctgtttactatgaaagttcaccaatcaaactgat |
42121395 |
T |
|
| Q |
198 |
ttt |
200 |
Q |
| |
|
||| |
|
|
| T |
42121394 |
ttt |
42121392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 3 - 78
Target Start/End: Complemental strand, 42121669 - 42121594
Alignment:
| Q |
3 |
tggaatcgtgatatgctgctgggtggaagcaccaacgaatctttataatgttacaatcataataacaagactgtaa |
78 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42121669 |
tggaatcgtgatatgctgctgcatggaagcaccaatgaatctttataatgttaccatcataataacaagactgtaa |
42121594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University