View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9807_low_8 (Length: 325)
Name: NF9807_low_8
Description: NF9807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9807_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 35 - 315
Target Start/End: Complemental strand, 19175542 - 19175262
Alignment:
| Q |
35 |
tacaattaaaaactatgatttgatttatataaggagaccatgagaccagtctctaaactctatgcagtagtgttgaaagaattttatggtttaaaagttt |
134 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
19175542 |
tacaattaagaactatgatttgatttgtataaggagaccatgagaccagtctctaaactctatggagtagtgttgaaagaattttatggttaaaaagttt |
19175443 |
T |
|
| Q |
135 |
atattctcaaaatattttattgcttttttagaccaattaatatactttgtcctttgtatctgtgtttagtagagacacttcgtattgaaagattgtttag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
19175442 |
atattctcaaaatattttattgcttttttagaccaattaatatactatatcctttgtatgtgtatgtagtagagacacttcgtattgaaagattgtttag |
19175343 |
T |
|
| Q |
235 |
tgtcctataacaacacatataattacaataaattattatttatgtcatgtgtcggtgtcaatgttgtgtcctatgtctgtg |
315 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19175342 |
tgtcctacaacaacgcatataattacaataaattattatttgtgtcatgtgtcagtgtcaatgttgtgtcctatgtctgtg |
19175262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University