View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9808_high_5 (Length: 242)
Name: NF9808_high_5
Description: NF9808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9808_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 227
Target Start/End: Original strand, 45515565 - 45515788
Alignment:
| Q |
4 |
ttgaattgagttaaatatagagagatataaagcttaccgttgttgttgttgctgttaccgggtaagtagagttgttgtggcacagtttccatttccaaca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45515565 |
ttgaattgagttaaatatagagagatataaagcttaccgttgttgttgttgctgttactgggtaagtagagttgttgtggcacagtttccatttccaaca |
45515664 |
T |
 |
| Q |
104 |
acaacaaaaccatgacgatgacgatgacgacgacgaagacggcacgcccactccacttgttgatattgcaattgcaattgaacttgttgcatttccacac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45515665 |
acaacaaaaccatgacgatgacgatgacgacgacgaagacggcacgcccactccacttgttgatattgcaattgcaattgaacttgttgcatttccacac |
45515764 |
T |
 |
| Q |
204 |
cacctcattttcccacaacttcct |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45515765 |
cacctcattttcccacaacttcct |
45515788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University