View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9808_high_8 (Length: 239)
Name: NF9808_high_8
Description: NF9808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9808_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 49103446 - 49103653
Alignment:
| Q |
16 |
atattggcctagtgatttgcaatgaagccatgtagcatctatgcagtttagcagttaaagttgctgagagaagcttagaagatgatgattgtgacacatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49103446 |
atattggcctagtgatttgcaatgaagccatgtagcatctatgcagtttagcagttaaagttgctgagagaagcttagaagatgatgattgtgacacatt |
49103545 |
T |
 |
| Q |
116 |
ggggttgtaagggaaatttgttcttgcccttgttccacacattaatcttgctgcttcatcgtatgctctagctgcatcctctgcagtttcaaaagtacca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49103546 |
ggggttgtaagggaaatttgttcttgcccttgttccacacattaatcttgctgcttcatcgtatgctctagctgcatcctctgcagtttcaaaagtacca |
49103645 |
T |
 |
| Q |
216 |
agccatat |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
49103646 |
agccatat |
49103653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 66 - 208
Target Start/End: Complemental strand, 1726412 - 1726270
Alignment:
| Q |
66 |
gcagttaaagttgctgagagaagcttagaagatgatgattgtgacacattggggttgtaagggaaatttgttcttgcccttgttccacacattaatcttg |
165 |
Q |
| |
|
||||||||||||||||| ||||||||||| || || ||||||| |||| |||||||| |||||||| || | ||| ||| ||||||||||||||||| |
|
|
| T |
1726412 |
gcagttaaagttgctgaaagaagcttagatgaagaagattgtggtccatttgggttgtatgggaaattggtacgtgcttttggtccacacattaatcttg |
1726313 |
T |
 |
| Q |
166 |
ctgcttcatcgtatgctctagctgcatcctctgcagtttcaaa |
208 |
Q |
| |
|
|||||||||| |||||||| |||||||| ||||| |||||||| |
|
|
| T |
1726312 |
ctgcttcatcatatgctcttgctgcatcttctgctgtttcaaa |
1726270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 222
Target Start/End: Original strand, 44331788 - 44331842
Alignment:
| Q |
168 |
gcttcatcgtatgctctagctgcatcctctgcagtttcaaaagtaccaagccata |
222 |
Q |
| |
|
||||||||||| ||||| |||||| | |||||||||||||| || |||||||||| |
|
|
| T |
44331788 |
gcttcatcgtaagctcttgctgcagcttctgcagtttcaaatgttccaagccata |
44331842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University