View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9809_low_11 (Length: 244)
Name: NF9809_low_11
Description: NF9809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9809_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 244
Target Start/End: Complemental strand, 20897356 - 20897125
Alignment:
| Q |
13 |
catcaaatagtggaacaacatccatgcttgcatcttcaactttatctgtatcttcggattctttcctccctttccgaatattgttaattctatctttcca |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20897356 |
catcaaatagtggaataacatccatgcttgcatcttcaactttatctgtatcttcggattctttcctccctttccgaatattgttaattctatctttcca |
20897257 |
T |
|
| Q |
113 |
gtcctgctttgttccgaaatgtcgaggtctccactttatctgcttcagttcaacaagaaactgcacaattccatcatattcataaatatcacctaataaa |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20897256 |
gtgctgctttgttccgaaatgtcgaggtctccactttatctgcttcagttcaacaagaaactgcacaattccatcacattcataaatatcacctaataaa |
20897157 |
T |
|
| Q |
213 |
catttacacacaacacaaacagataggtgaac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20897156 |
catttacacacaacacaaacagataggtgaac |
20897125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University