View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9809_low_9 (Length: 270)
Name: NF9809_low_9
Description: NF9809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9809_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 8 - 261
Target Start/End: Complemental strand, 4417592 - 4417339
Alignment:
| Q |
8 |
agttcaatctgatgcaaaaaattactgataattactttgtgcaaaatgtaaaatatatgttgaaataaacaattagtctctacatttttgccagattttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417592 |
agttcaatctgatgcaaaaaattactgataattactttgtgcaaaatgtaaaatatatgttgaaataaacaattagtctctacatttttgccagattttt |
4417493 |
T |
|
| Q |
108 |
attttgattcctttagtttgtcttgagtagaaaccacaagatgatcaatgttgtggaaaataaattctacatgaaggtatatcatatttagatcactatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417492 |
attttgattcctttagtttgtcttgagtagaaaccacaagatgatcaatgttgaggaaaataaattctacatgaaggtatatcatatttagatcactatg |
4417393 |
T |
|
| Q |
208 |
cttacccatgagcatgatcgatgcagtggaaccgagcagcatcgtgacctttgc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417392 |
cttacccatgagcatgatcgatgcagtggaaccgagcagcatcgtgacctttgc |
4417339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University