View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9810_high_11 (Length: 227)
Name: NF9810_high_11
Description: NF9810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9810_high_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 46146695 - 46146469
Alignment:
| Q |
1 |
tgcagttgaagtggaagtactaggaagggtgaggcataagaatttgttaggattgagggggttctatgcaggaggagatgaaaggttaattgtgtatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46146695 |
tgcagttgaagtggaagtactaggaagggtgaggcataagaatttgttaggattgagggggttctatgcaggaggagatgaaaggttaattgtgtatgat |
46146596 |
T |
|
| Q |
101 |
tacatgcctaatcatagcttgctcactcatttacatggtcaacttgcttcagattgtttactagattggcctagaagaatgagcataacagttggtgcag |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46146595 |
tacatgtctaatcatagcttgctcactcatttacatggtcaacttgcttcagattgtttacttgattggcctagaagaatgagcataacagttggtgcag |
46146496 |
T |
|
| Q |
201 |
ctgaaggtttagcgtgagtataccttc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46146495 |
ctgaaggtttagcgtgagtataccttc |
46146469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University