View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9811_low_11 (Length: 237)
Name: NF9811_low_11
Description: NF9811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9811_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 33723462 - 33723255
Alignment:
| Q |
13 |
caaaggaagaaggaactaaaacgctttccaaagatnnnnnnnttgtgtgctccaagataaattataaggtaatataatattgatgatttagttcaaaata |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33723462 |
caaatgaagaaggaactaaaacgctttccaaagataaaaaatttgtgtagtccaagataaattataaggtaatataatattgatgatttagttcaaaata |
33723363 |
T |
 |
| Q |
113 |
gtctacttgacaaaatgatgagtttgttagaaaaattgtttttggagaagatggtgcaacacttgaacaatgaagattgcactttagaatactagagtgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33723362 |
gtctacttgacaaaatgatgagtttgttagaaaaattgttgttggagaagatggtgcaacacttgaacaatgaagattgcactttagaataccagagtgc |
33723263 |
T |
 |
| Q |
213 |
gtgtttct |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
33723262 |
gtgtttct |
33723255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University