View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9811_low_13 (Length: 232)
Name: NF9811_low_13
Description: NF9811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9811_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 44079591 - 44079477
Alignment:
| Q |
20 |
agaccccaaatttgcttgttgataaactacgtgaagagaataaatccattatggtcacactttgttttaaaccatgttatacaccatgtctgtaacatac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44079591 |
agaccccaaatttgcttgttgataaactacgtgaagagaataaatccattatggtcacactttgttttaaaccatgttatacaccatgtttgtaacatac |
44079492 |
T |
|
| Q |
120 |
aatatgcaatatatc |
134 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44079491 |
aatatgcaatatatc |
44079477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University