View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9811_low_14 (Length: 219)
Name: NF9811_low_14
Description: NF9811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9811_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 52396479 - 52396287
Alignment:
| Q |
17 |
aagaatcagtacttaccgaagaagaagaag---gtgctacagcttctcacgcaattcatatcaaagaagaagttcttgaagaagacgacggtgcta---a |
110 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52396479 |
aagaatcagtactaaccgaagaagaagaagaaggtgctacagcttctcacgcaattcatatcaaagaagaagttcttgaagaagacgacggtgctgctca |
52396380 |
T |
|
| Q |
111 |
cgcttcatcttcactcaggtttccaaaaccaatggaagggctacatgaggttggtccaccaccgtttctcaagaaaacttttgaaatggtgga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52396379 |
cgcttcatcttcactcaggtttccaaaaccaatggaagggctacatgaggttggtccaccaccgtttctcaagaagacttttgaaatggtgga |
52396287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University