View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9811_low_6 (Length: 274)
Name: NF9811_low_6
Description: NF9811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9811_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 56 - 187
Target Start/End: Complemental strand, 2625995 - 2625864
Alignment:
| Q |
56 |
tcatcttaatctcaatctatctctttttcgtttgttctttctcatgatccgttcatgatgattaattgttggagaaacatttatgaaagagacaaaatct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2625995 |
tcatcttaatctcaatctatctctttttcgtttgttctttctcactatccgttcatgatgattaattgttggagaaacatttatgaaagagaccaaatcc |
2625896 |
T |
 |
| Q |
156 |
ttaaacgttcggtttgtaagttgcatcaagtt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2625895 |
ttaaacgttcggtttgtaagttgcatcaagtt |
2625864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 193 - 274
Target Start/End: Complemental strand, 2625800 - 2625719
Alignment:
| Q |
193 |
tatttgtattcttgcacattaataatcacatcgttcgacattagtacttgtattcttttacgtgaatcaccataaataattc |
274 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625800 |
tatttatattcttgcacattaataatcacatcgttcgacattagtacttgtattcttttacgtgaatcaccataaataattc |
2625719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 91 - 177
Target Start/End: Complemental strand, 2619247 - 2619160
Alignment:
| Q |
91 |
tctttctcatgatcc-gttcatgatgattaattgttggagaaacatttatgaaagagacaaaatctttaaacgttcggtttgtaagtt |
177 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| |||||| ||||||||||||||||||| | |||||| ||| ||| ||||||| |
|
|
| T |
2619247 |
tctttctcacgatcccgttcatgatgattaattgttagagaaaaatttatgaaagagacaaaacccttaaacattcagttagtaagtt |
2619160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University