View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9811_low_9 (Length: 249)
Name: NF9811_low_9
Description: NF9811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9811_low_9 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 60 - 249
Target Start/End: Complemental strand, 11833775 - 11833586
Alignment:
| Q |
60 |
gaacccgaacaaagagatctagaaagcactaggaagaaatctttctaccatttcacccataaccgttatccatctaacgacaatgcatgacgtcaatgac |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11833775 |
gaacccgaacaaagagatctagaaagcactaggaagaaatctctctaccatttcacccataaccgttatccatctaacgacaatgcatgacgtcgatgac |
11833676 |
T |
|
| Q |
160 |
atggattttgaatgtggggcattatcgtgtgaacggtggctttgccactatgcatagttttccatactttcggatctgcaacgttgatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11833675 |
atggattttgaatgtggggcattatcgtgtcaacggtggcttcgccactatgcatagctttccatactttcggatctgcaacgttgatgt |
11833586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 11833852 - 11833802
Alignment:
| Q |
1 |
tggctagaagttggattaatccaacaactaagagacatacatatagagaga |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11833852 |
tggctagaagttggattaatccaacaactaagagacatacatatagagaga |
11833802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University