View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9812_high_20 (Length: 234)
Name: NF9812_high_20
Description: NF9812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9812_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 132 - 229
Target Start/End: Original strand, 22363475 - 22363572
Alignment:
| Q |
132 |
attttattgttatgaacaattaaaatttgccatgtgtcaattttttatgtggaggtcaaatggtgattgccacctaaagtggtatgcctatcaccact |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
22363475 |
attttattgttatgaacaattaaaatttaccatgtgtcaattttttatgtggaggtcaaatggtgtttgccacctaaaggggtatgcctatcaccact |
22363572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 137 - 229
Target Start/End: Complemental strand, 27007897 - 27007805
Alignment:
| Q |
137 |
attgttatgaacaattaaaatttgccatgtgtcaattttttatgtggaggtcaaatggtgattgccacctaaagtggtatgcctatcaccact |
229 |
Q |
| |
|
|||||| |||| | ||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
27007897 |
attgttttgaatagttaaagtttgccatgtgtcaattttttgtgtggaggtcaaatggtgtttgccacctaaggaggtatgcctatcaccact |
27007805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 137 - 229
Target Start/End: Complemental strand, 1493449 - 1493357
Alignment:
| Q |
137 |
attgttatgaacaattaaaatttgccatgtgtcaattttttatgtggaggtcaaatggtgattgccacctaaagtggtatgcctatcaccact |
229 |
Q |
| |
|
|||||| |||| | ||||| |||| |||||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
1493449 |
attgttttgaatagttaaagtttgtcatgtgtcaattttttgtgtggaggtcaaatggtgtttgccacctaaggaggtatgcctatcaccact |
1493357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 29322874 - 29322946
Alignment:
| Q |
157 |
tttgccatgtgtcaattttttatgtggaggtcaaatggtgattgccacctaaagtggtatgcctatcaccact |
229 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
29322874 |
tttgccaagtgtcaattttttatgtggaggtcaaatggtgtttgccacctatgatggtatgcctatcaccact |
29322946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University