View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9812_low_12 (Length: 337)
Name: NF9812_low_12
Description: NF9812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9812_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 88 - 144
Target Start/End: Complemental strand, 15049921 - 15049865
Alignment:
| Q |
88 |
tatggccgactagtgaaccattaaccaccacccccataacgacctctcaccggcgca |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15049921 |
tatggccgactagtgaaccattaaccaccacccccataacgacctctcaccgacgca |
15049865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 97 - 144
Target Start/End: Original strand, 1653874 - 1653921
Alignment:
| Q |
97 |
ctagtgaaccattaaccaccacccccataacgacctctcaccggcgca |
144 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
1653874 |
ctagtgaaccattaacgaccacccccataacgacctctcactggcgca |
1653921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 90 - 137
Target Start/End: Complemental strand, 26841854 - 26841807
Alignment:
| Q |
90 |
tggccgactagtgaaccattaaccaccacccccataacgacctctcac |
137 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26841854 |
tggccggctagtgaaccattaaccaccaccctcataacgacctctcac |
26841807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University