View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9812_low_17 (Length: 287)
Name: NF9812_low_17
Description: NF9812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9812_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 269
Target Start/End: Original strand, 20049876 - 20050135
Alignment:
| Q |
14 |
agagagagaaaccaaaaaagaacgaaatagagatatgagaggctgatatatctaatgtacttatttatgtaacggaaagaaagcttataacttgcacttt |
113 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
20049876 |
agagagagaagccaaaaaagaacgaaatagacatatgagaggctgatatatctaatgtacttatttttgtaacggaaaaaaagcttataacttgc-cttt |
20049974 |
T |
 |
| Q |
114 |
aaacattgcacttataatgaaatcaaaataaattgtggcaaatacatgtggtgtacccactctactcccgatagagg-----ccgaagacccattttact |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
20049975 |
aaacattgcacttataatgaaatcaaaataaattgtggcaaatacatgtggtgtacccactctactcccaatagaggccgtcccgaagacccattttact |
20050074 |
T |
 |
| Q |
209 |
ttttgtatatcgattaaattgtttataattccttaggatttgtattatcatctcgcaaata |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20050075 |
ttttgtatatcgattaaattgtttataattccttaggatttgtattatcatctcgcaaata |
20050135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University