View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9812_low_33 (Length: 227)
Name: NF9812_low_33
Description: NF9812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9812_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 32179745 - 32179939
Alignment:
| Q |
21 |
agttcacgcttgcacgcgctagaggcgcgtaggtagatagcacaccggagaaggcagcagaggaagttgatcggaaaagcagctttctccgacggaaaga |
120 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32179745 |
agttcgcgcttgcacgcgcttgaggcgcgtaggtagatagcacaacggagaagacagcagaggaagttgatcggaaaagcagctttctccgacggaaaga |
32179844 |
T |
|
| Q |
121 |
gagggacgatggattgtagaatctcacgttgttcggattttgtttctgaatcggaatctgttgaatcagatgaccggaattttcctccaccacca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32179845 |
gagggacgatggattgtagaatctcacgttgttcggattttgtttctgaatcggaatctgttgaatcagatgaccggaattttcctccaccacca |
32179939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 122
Target Start/End: Original strand, 28250185 - 28250265
Alignment:
| Q |
42 |
gaggcgcgtaggtagatagcacaccggagaaggcagcagaggaagttgatcggaaaagcagctttctccgacggaaagaga |
122 |
Q |
| |
|
|||||||| |||| ||| || || ||||| |||||||| ||||||||||| |||||||| ||||||||||| || |||||| |
|
|
| T |
28250185 |
gaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctccgaagggaagaga |
28250265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University