View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9813_high_6 (Length: 244)
Name: NF9813_high_6
Description: NF9813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9813_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 139 - 225
Target Start/End: Complemental strand, 14700942 - 14700856
Alignment:
| Q |
139 |
ggatcctaaatcggtttctctccctaaataacaaaaactagtcgtattttcccgcttttattattttcttcttttccgctccccaca |
225 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14700942 |
ggatcccaaatttgtttctctccctaaataacaaaaactagtcatattttcccgcttttattattttcttcttttccgctccccaca |
14700856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 136 - 226
Target Start/End: Original strand, 17648482 - 17648581
Alignment:
| Q |
136 |
gatggatcctaaatcggtttctctccctaaataacaaaaact---------agtcgtattttcccgcttttattattttcttcttttccgctccccacat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17648482 |
gatggatcctaaatcggtttctctccctaaataacaaaaactaggagaactagtcgtattttcccgcttttattattttcttcttttccgctccctacat |
17648581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University