View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9813_high_9 (Length: 209)
Name: NF9813_high_9
Description: NF9813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9813_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 37929619 - 37929443
Alignment:
| Q |
16 |
ggtgttaggagtaaatatattatttcaggttgcaaccttttccaatgtccttttcccgtattctttcacaaacccttcagctatccattgatttgtcagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37929619 |
ggtgttaggagtaaatatattatttcaggctgcaaccttttccaatgtcctttccccgtattctttcacaaacccttcagctatccattgatttgtcagt |
37929520 |
T |
|
| Q |
116 |
ttgaagaaaatcttccaatgtctcattccatcgagttgtcaagacagccagaaaaatttagagttagacctacatta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37929519 |
ttgaagaaaatcttccaatgtctcattccatcgagttgtcaagatagccagaaaaatttagagttagacctacatta |
37929443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 46 - 106
Target Start/End: Original strand, 22442332 - 22442392
Alignment:
| Q |
46 |
tgcaaccttttccaatgtccttttcccgtattctttcacaaacccttcagctatccattga |
106 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22442332 |
tgcaaccttttccaatgtcctttccccatattctttcacaaacccttcagctatccattga |
22442392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 37930451 - 37930501
Alignment:
| Q |
47 |
gcaaccttttccaatgtccttttcccgtattctttcacaaacccttcagct |
97 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
37930451 |
gcaaccttttccaatgtcctttcctcgtattctttcacaaacccttcagct |
37930501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 106
Target Start/End: Original strand, 22353402 - 22353462
Alignment:
| Q |
46 |
tgcaaccttttccaatgtccttttcccgtattctttcacaaacccttcagctatccattga |
106 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
22353402 |
tgcaacctcttccattgtccttcccccgtattctttcacaaacccctcagcaatccattga |
22353462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 106
Target Start/End: Original strand, 22367514 - 22367574
Alignment:
| Q |
46 |
tgcaaccttttccaatgtccttttcccgtattctttcacaaacccttcagctatccattga |
106 |
Q |
| |
|
|||||||| |||||||||| || || | ||||||||||||||||||||| ||||||||| |
|
|
| T |
22367514 |
tgcaacctcttccaatgtcattcccctttcttctttcacaaacccttcagcaatccattga |
22367574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 105
Target Start/End: Complemental strand, 34990074 - 34990046
Alignment:
| Q |
77 |
tctttcacaaacccttcagctatccattg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34990074 |
tctttcacaaacccttcagctatccattg |
34990046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University