View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9813_low_10 (Length: 244)

Name: NF9813_low_10
Description: NF9813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9813_low_10
NF9813_low_10
[»] chr7 (1 HSPs)
chr7 (139-225)||(14700856-14700942)
[»] chr5 (1 HSPs)
chr5 (136-226)||(17648482-17648581)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 139 - 225
Target Start/End: Complemental strand, 14700942 - 14700856
Alignment:
139 ggatcctaaatcggtttctctccctaaataacaaaaactagtcgtattttcccgcttttattattttcttcttttccgctccccaca 225  Q
    |||||| ||||  |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
14700942 ggatcccaaatttgtttctctccctaaataacaaaaactagtcatattttcccgcttttattattttcttcttttccgctccccaca 14700856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 136 - 226
Target Start/End: Original strand, 17648482 - 17648581
Alignment:
136 gatggatcctaaatcggtttctctccctaaataacaaaaact---------agtcgtattttcccgcttttattattttcttcttttccgctccccacat 226  Q
    ||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||| ||||    
17648482 gatggatcctaaatcggtttctctccctaaataacaaaaactaggagaactagtcgtattttcccgcttttattattttcttcttttccgctccctacat 17648581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University