View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9815_low_11 (Length: 270)
Name: NF9815_low_11
Description: NF9815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9815_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 25003737 - 25003980
Alignment:
| Q |
10 |
ttgttcttctcaaatatgtcttgcgtctcttatagtttatttgttttccttttccaagctcccacaagaaggatattcgcaattgttttcaaatgatatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
25003737 |
ttgttcttctcaaatatgtcttgcgtctcttatagtttatttgttttccttttccaagctcccacaagaaggatattcacaattgttttcaaatgatttg |
25003836 |
T |
|
| Q |
110 |
gatgactttcatttggattatttagaaggagcggaatctcatgaattttcttaataaagagttgtcttttgctcagattgttgatagagaaaaacttcat |
209 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25003837 |
gatgactttcatttagattatttggaaggagcagaatctcatgaattttcttaataaagagttgtcttttgctcagattgttgatagagaaaaacttcat |
25003936 |
T |
|
| Q |
210 |
tcatggcggtctaaggtgtacatgtctagtttagcgtttgatct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25003937 |
tcatggcggtctaaggtgtacatgtctagtttagcttttgatct |
25003980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 82 - 176
Target Start/End: Original strand, 40155365 - 40155459
Alignment:
| Q |
82 |
atattcgcaattgttttcaaatgatatggatgactttcatttggattatttagaaggagcggaatctcatgaattttcttaataaagagttgtct |
176 |
Q |
| |
|
||||||||| ||| ||||||||||| |||||||| |||||| || |||||||||||||| |||||||||| ||||| ||||| |||| |||| |
|
|
| T |
40155365 |
atattcgcacttgctttcaaatgatttggatgacaaccatttgaataatttagaaggagcgtaatctcatgatttttcaaaataaggagtcgtct |
40155459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University