View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9815_low_15 (Length: 232)
Name: NF9815_low_15
Description: NF9815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9815_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5270182 - 5269961
Alignment:
| Q |
1 |
tgctcttcaattggacaacaccatctcaaaagctagaaacaaacaaacattggtagctacgacctataataatactggtcagagacatattttcacattc |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
5270182 |
tgctcttcaattgaacaacaccatctcaaaagctagaaacaaacaaacattggtagcaacgacctataataataatggtcagaaacatgttttcacattc |
5270083 |
T |
|
| Q |
101 |
aatgtttagaatataaggttgttatatgcaaaagagtgatggttaaaattgtcttgaacattcaaaaatcatttgtagcatttcctcgaaaattgatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5270082 |
aatgtttagaatataaggttgttatatgcaaaagagtgatggttaaaattgtcttgaacattcaaaaatcatttgtagcatttcctcgaaaattgatatt |
5269983 |
T |
|
| Q |
201 |
caaagcaagaattctctgcttc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5269982 |
caaagcaagaattctctgcttc |
5269961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University