View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9815_low_2 (Length: 485)
Name: NF9815_low_2
Description: NF9815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9815_low_2 |
 | |
|
| [»] scaffold0011 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 6 - 195
Target Start/End: Original strand, 239848 - 240037
Alignment:
| Q |
6 |
tttggtgtttgcacatagctctctcataaaaagataatggtgaattaagcttatgtcaaaacgatatgcatttttatcagttttgacgcatggagatttc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
239848 |
tttggtgtttgcacatagctctctcataaaaagataatggtgaattaagcttatgtcaaaacgatatgcatttttatcagttttgacgcatggagatttc |
239947 |
T |
|
| Q |
106 |
tatacagctatgaagcacatgctccttggattaggcgtgtcccgttatctgatacgtatcatgtccgacatgatgtcaccgacacatatg |
195 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
239948 |
tatatagctatgaagcacatgctccttggattaggcgtgtcccgttatctgatacgtatcatgtccgacatgatgacaccgacacatatg |
240037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 241 - 470
Target Start/End: Original strand, 240077 - 240296
Alignment:
| Q |
241 |
tgtcaacatgtccgtgtcatgtccggtgtccgtgtctgagtttatgctttatagctatacagacaatcgacttattatctcttgcttctgattttggggg |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240077 |
tgtcaacatgtccgtgtcatgtccggtgtccgtgtctgagtttatactttatagctatacagacaatcgacttattatctcttgcttctgattttggggg |
240176 |
T |
|
| Q |
341 |
atagcatgttgctgccctgtgtagggagtgttggtggcaataagttgtggccatgtcatcatgtagtttcatgtaatcatgttgcatcaaatgaagaagg |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
240177 |
atagcatgttgctgccctgtgtagggagtgttgatggcaataaattgtggccatgtca----------tcatgtaatcatgttgcatcaaatggagaagg |
240266 |
T |
|
| Q |
441 |
acggtccttggatattagaggatgcttgtg |
470 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
240267 |
acggtccttggatattagaggatgcttgtg |
240296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 249 - 283
Target Start/End: Complemental strand, 56049872 - 56049838
Alignment:
| Q |
249 |
tgtccgtgtcatgtccggtgtccgtgtctgagttt |
283 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
56049872 |
tgtccgtgtcgtgtccggtgtccgtgtctgagttt |
56049838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 240 - 276
Target Start/End: Original strand, 5970163 - 5970199
Alignment:
| Q |
240 |
gtgtcaacatgtccgtgtcatgtccggtgtccgtgtc |
276 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
5970163 |
gtgtcgacgtgtccgtgtcatgtccggtgtccgtgtc |
5970199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University