View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9816_1 (Length: 484)
Name: NF9816_1
Description: NF9816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9816_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 130 - 428
Target Start/End: Original strand, 38592421 - 38592714
Alignment:
| Q |
130 |
atagcatggtgcatacttttgttcatatgtgattgtcataatactttgcaacgtcttagattcaaattgaaaacttatggttcagcttatcaaccggtac |
229 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38592421 |
atagaatggtgcatacttttgttcatatgtgattgtcataatactttgcaacgtcttagattcaaattgaaaacttatggttcagcttatcaaccggtac |
38592520 |
T |
|
| Q |
230 |
tccgatgaatgtttgtctttattgctttatttaggtcatatggctacgtttagtttagtttaagtatttttgagcattctaatcctctgttagactcttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38592521 |
tccgatgaatgtttgtctttattgctttatttaggtcatatggctac-----gtttagtttaagtatttttgagcattctaatcctctgttagactcttt |
38592615 |
T |
|
| Q |
330 |
gttgttaattgatggcaagaccattagtaatcctcttgtttatcattaattaaattccatttctatcaaaaaagggagtaaacgataaattgttccctt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38592616 |
gttgttaattgatggcaagaccattagtcatcctcttgtttatcattaactaaattccatttctatcaaaaaagggagtaaacgataaattgtttcctt |
38592714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 414 - 467
Target Start/End: Original strand, 38592725 - 38592778
Alignment:
| Q |
414 |
ataaattgttcccttcaaatatgtgatttagcatcaaaattaccgagactaaaa |
467 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38592725 |
ataaattgttcgcttcaaatatgtgatttagcatcaaaattaccgagactaaaa |
38592778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University