View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9817_high_11 (Length: 236)
Name: NF9817_high_11
Description: NF9817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9817_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 6510983 - 6510790
Alignment:
| Q |
19 |
cataggacaaaggtgtattggctaaaagatggtggcacaaactcgcggttttttcatgctatggctaccaccaataagaggcaaaacaatatcacaaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6510983 |
cataggacaaaggtgtattggctaaaagatggtgacacaaacttgcggttttttcatgctatggctaccaccaataagaggcaaaacaatatcacaaatt |
6510884 |
T |
 |
| Q |
119 |
tgagtagggatgatggggaaatggttatgtcgcagcaagagtggtgcggagtagctaataattattttattgaattatttgacaagggggaatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
6510883 |
tgagtagggatgatggggaaatggttatgtcgcagcaagagtggtgcggagtagctaataattattttgttgaattatttgacaaggcggaatg |
6510790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University