View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9817_low_18 (Length: 229)
Name: NF9817_low_18
Description: NF9817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9817_low_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 45693415 - 45693183
Alignment:
| Q |
7 |
aattatgcattatgtaaaataagcaaatttaggtgttacgcgtatggcggcaccgttgtattgtctctttggttagaggattgttcgtcttgtgcaggtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45693415 |
aattatgcattatgtaaaataagcaaatttaggtgttacgcgtatggcggcaccgttgtattgtctctttggttagaggattgttcgtcttgtgcaggtt |
45693316 |
T |
|
| Q |
107 |
tactcatctcttcgactaaaataaataattaaatatattttttgtcccattaaaattagtaaattgactgactctttttgtttttg----------ttga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
45693315 |
tactcatctcttcgactaaaataaataattaaatatattttttgtcccattaaaattagtaaattgactgactcgttttgtttttgttaaaattgattga |
45693216 |
T |
|
| Q |
197 |
ctcatttaattgtttttaattcttaaaatattt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45693215 |
ctcatttaattgtttttaattcttaaaatattt |
45693183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University