View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9817_low_5 (Length: 468)
Name: NF9817_low_5
Description: NF9817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9817_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 47 - 152
Target Start/End: Original strand, 38428687 - 38428793
Alignment:
| Q |
47 |
cacatatagaaaaacacattaaaaattgtcaatccacaacaaacatacttggggtaatatttta-cataataatactaaaatatatcaatacaaaaattg |
145 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
38428687 |
cacataaagaaaaacacattaaaaattgtcaatccacatcaaacatatttggggtaataatttagcataataatcctaaagtatatcaatacaaaaattg |
38428786 |
T |
 |
| Q |
146 |
gggtgtt |
152 |
Q |
| |
|
||||||| |
|
|
| T |
38428787 |
gggtgtt |
38428793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 25487183 - 25487135
Alignment:
| Q |
1 |
aaagagatgtgggttttcctgaaaattttgtattatataatatgagcac |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25487183 |
aaagagatgtgggttttcctgaaaattttgatttatataatatgagcac |
25487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 12 - 49
Target Start/End: Original strand, 25433592 - 25433629
Alignment:
| Q |
12 |
ggttttcctgaaaattttgtattatataatatgagcac |
49 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
25433592 |
ggttttcctgaaaaatttgtatgatataatatgagcac |
25433629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University