View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9819_high_12 (Length: 209)
Name: NF9819_high_12
Description: NF9819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9819_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 22362955 - 22362774
Alignment:
| Q |
16 |
cagttttgacccctctacaagtttaggtgatacttttcaggtacatatatgcatctataatttcacatgtttcacttacatattatccactttatgttaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22362955 |
cagttttgacccctctacaagtttaggtgatacttttcaggtacatatatgcttctataatttcacatgtttcactcacatattatccactttatgttat |
22362856 |
T |
 |
| Q |
116 |
cttgttaccatgtttttctaacattcttcaattttatgtagcctttctatattggtggaggagataatcaacaatctgtgct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362855 |
cttgttaccatgtttttctaacattcttcaattttatgtagcctttctatattggtggaggagataatcaacaatctgtgct |
22362774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University