View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9819_high_6 (Length: 276)
Name: NF9819_high_6
Description: NF9819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9819_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 63 - 258
Target Start/End: Complemental strand, 40807707 - 40807512
Alignment:
| Q |
63 |
attattgtgcatgtg-tcttacttctattggatgaaaaattatgattctgcaattggcgaaaaatacacttggtagtgtgggtgaaaattttagccactg |
161 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
40807707 |
attattgtgcatgtaatcttacttctattggatgaaaaattatgattctgcaattggcgaaaaatacacc-ggtagtgtgggtgaaaattttagccaccg |
40807609 |
T |
 |
| Q |
162 |
tcctttatcggatgacactccttcgtaacaatatcatcctttcccttcnnnnnnnagtttatgaatttatgtatatttgcttctttaacgtaaatct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40807608 |
tcctttatcggatgacactccttcgtaacaatatcatcctttcccttctttttttagtttatgaatttatgtatatttgcttctttaacgtaaatct |
40807512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University