View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9819_high_9 (Length: 229)
Name: NF9819_high_9
Description: NF9819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9819_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 215
Target Start/End: Original strand, 37556346 - 37556546
Alignment:
| Q |
15 |
ttggtgtttgatgcagatgtatagcgactatatgaagagttttagagagaatatggcagatttcttagaatcggagctactgatagacattgaagtagga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37556346 |
ttggtgtttgatgcagatgtatagcgactatatgaagagttttagagagaatatggcagatttcttagaatcggagctactgatagacattgaagtagga |
37556445 |
T |
 |
| Q |
115 |
cttggccctgctggagaactcagatatccttcttatgcagaatctctaggctgggtatttcctggtattggagaatttaatgtgagtttgtgaatttttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37556446 |
cttggccctgctggagaactcagatatccttcttatgcagaatctctaggctgggtatttcctggtattggagaatttaatgtgagtttgtgaatttttt |
37556545 |
T |
 |
| Q |
215 |
g |
215 |
Q |
| |
|
| |
|
|
| T |
37556546 |
g |
37556546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University