View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9819_low_13 (Length: 229)
Name: NF9819_low_13
Description: NF9819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9819_low_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 5 - 229
Target Start/End: Complemental strand, 37268992 - 37268770
Alignment:
| Q |
5 |
caattttatcaacacattttttgtcaccgtgatattagtacgaagtttccactatcgtttaaacatgactaatctttgtcagaaaatctatagaacacat |
104 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37268992 |
caattttatcaacacatttt--gtcaccatgatattagtacgaagtttccactatcgtttaaccatgactaatctttgtcagaaaatctatagaacacat |
37268895 |
T |
 |
| Q |
105 |
aaggtggattctccccttccaaccagattttttccatttgtatgagtcggaagtcaaacctcaaacaaatacataaaaggctaaagtttctcgtcacttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||| |
|
|
| T |
37268894 |
aaggtggattctccccttccaaccagattttttccatttgtatgagtcggaagtcaaacctcagacaaatacataaaaggctaaagtttatggtcacttg |
37268795 |
T |
 |
| Q |
205 |
aacaaatctattgttagtattttat |
229 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
37268794 |
aacaaatctactgttagtattttat |
37268770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University