View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9819_low_8 (Length: 276)

Name: NF9819_low_8
Description: NF9819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9819_low_8
NF9819_low_8
[»] chr5 (1 HSPs)
chr5 (63-258)||(40807512-40807707)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 63 - 258
Target Start/End: Complemental strand, 40807707 - 40807512
Alignment:
63 attattgtgcatgtg-tcttacttctattggatgaaaaattatgattctgcaattggcgaaaaatacacttggtagtgtgggtgaaaattttagccactg 161  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| |    
40807707 attattgtgcatgtaatcttacttctattggatgaaaaattatgattctgcaattggcgaaaaatacacc-ggtagtgtgggtgaaaattttagccaccg 40807609  T
162 tcctttatcggatgacactccttcgtaacaatatcatcctttcccttcnnnnnnnagtttatgaatttatgtatatttgcttctttaacgtaaatct 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||    
40807608 tcctttatcggatgacactccttcgtaacaatatcatcctttcccttctttttttagtttatgaatttatgtatatttgcttctttaacgtaaatct 40807512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University