View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_high_12 (Length: 253)
Name: NF9820_high_12
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 236
Target Start/End: Original strand, 14507946 - 14508171
Alignment:
| Q |
12 |
ataggttagggagtgcaatattttagaacaggtgtggcatagatttcattgaaagattttctttatcctttacttcgccgtcaaggatattactataatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14507946 |
ataggttagggagtgcaatattttagaacaggtgtggcatagatttcattgaaagattttctttatcctttacttcgccgtcaaggatattactataatc |
14508045 |
T |
 |
| Q |
112 |
ctcttcctagcctttaa-tttgaagtggtataatgataggcaagaaacatttgcatttaatttccaatggggtgacttagtattacaattcttggtatct |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14508046 |
ctcttcctagcctttaattttgaagtggtataatgattggcaagaaacatttgcatttaatttccaatggggtgacttagtattacaattcttggtatct |
14508145 |
T |
 |
| Q |
211 |
aataggtactactaagagtaagaata |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14508146 |
aataggtactactaagagtaagaata |
14508171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University