View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_10 (Length: 414)
Name: NF9820_low_10
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 18 - 406
Target Start/End: Original strand, 32505024 - 32505409
Alignment:
| Q |
18 |
gttgtagggtgggttcaaataatcaaatacaagcagagctcaaaaccatgcataacaatagcacttaattagaaaatcacagaactagcttatcatacag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505024 |
gttgtagggtgggttcaaataatcaaatacaag---agatcaaaaccatgcataacaatagcacttaattagaaaatcacagaactagcttatcatacag |
32505120 |
T |
 |
| Q |
118 |
ctcatctcattaaattgctattacccttccctttatcatgcatgattcctcaatggttaaaaaatttcatagctgaattactttaattgtgctaagatca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32505121 |
ctcatctcattaaattgctattacccttctctttatcatgcatgattcctcaatggttaaaaaatttcaaagctgaattactttaattgtgctaagatca |
32505220 |
T |
 |
| Q |
218 |
agaacaatgtgaatggtttgacaattgggtggggcagatgacatttgaagggtggtacgtatgagttctgcttacgactcgacaagacattgattttgtt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32505221 |
agaacaatgtgaatggtttgacaattgggtggggcagatgacatttgaagggtggtacgtatgagttctgcttaggactcgacaagacattgattttgtt |
32505320 |
T |
 |
| Q |
318 |
tctctctgtacatttacgtgtactgctaaccttcactgcccaattgccaacaaagtttttcattcatggggtcatgggaccatgacatg |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505321 |
tctctctgtacatttacgtgtactgctaaccttcactgcccaattgccaacaaagtttttcattcatggggtcatgggaccatgacatg |
32505409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University