View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_11 (Length: 403)
Name: NF9820_low_11
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 9 - 385
Target Start/End: Complemental strand, 44825032 - 44824656
Alignment:
| Q |
9 |
tcgtgttccaacaagaacaaatctttgtgggaggaatatacttccactggaggccaccttgtggtgtgtgtcgtgtgagaccgtggaggaatcggtaaac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44825032 |
tcgtgttccaacaagaacaaatctttgtgggaggaatatacttccactggaggccaccttgtggtgtgtgtcgtgtgagaccgtggaggaatcggtaaac |
44824933 |
T |
|
| Q |
109 |
cacctttttctccattgtcgagacacaatgtctatctgggctagtttaatgaggtggttgggattgagtttcattatgcctccagatttatttatccatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44824932 |
cacctttttctccattgtcgagacacaatgtctatctgggctaatttaatgaggtggttgggattgagtttcattatgcctccagatttatttatccatt |
44824833 |
T |
|
| Q |
209 |
gggaatgttgttggagtgggggtggggaagaggttgaaaagggggctgtggctaatttagcatgcagcgatttgggtcatttggacagtgagaaactata |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
44824832 |
gggaatgttgttggagtgggggtggggaagaggttgaaaaggggtctgtggctaatttggcatgcggcgatttgggtcatttggacagtgagaaacaata |
44824733 |
T |
|
| Q |
309 |
gaatctttagaaatgagattcgggaggtggatgagatagtggatggtgctgtcttagcgatggagtttggcaaggct |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44824732 |
gaatctttagaaatgagattcgggaggtggatgagatagtggatggtgctgtcttagcgatggagtttggcaaggct |
44824656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University