View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_19 (Length: 305)
Name: NF9820_low_19
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 6 - 143
Target Start/End: Complemental strand, 52589817 - 52589679
Alignment:
| Q |
6 |
attcaaaagtttgttttcactgttaaa-gaaaaatactaataagtattcttaaaacattagttagcagaacttttataaataagtatataagtgacgagt |
104 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||||||| ||||||||||||||||| |||||| ||||||||||||||| |||||| |||| |
|
|
| T |
52589817 |
attcaaaagtttgttttcactattaaaagaaaaatattaataagtatccttaaaacattagttagtagaactcttataaataagtatacaagtgatgagt |
52589718 |
T |
|
| Q |
105 |
atgttctatcgatatcactaaatcaaataaggtatgagc |
143 |
Q |
| |
|
||||||||||||||||| | ||||||||||| ||||||| |
|
|
| T |
52589717 |
atgttctatcgatatcagtgaatcaaataagatatgagc |
52589679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 209 - 296
Target Start/End: Complemental strand, 52589613 - 52589526
Alignment:
| Q |
209 |
tggtcaattgtttaacatcgttgcaaaaatattacttttaaaggtcaaattcgtcatttactccttactcaaaacacaatttaccacc |
296 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52589613 |
tggtcaattgtttaacatcgttgcaataatattagttttaaaggtcaaactcgtcatctactccttactcaaaacacaatttaccacc |
52589526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University