View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_20 (Length: 305)
Name: NF9820_low_20
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 12550743 - 12551028
Alignment:
| Q |
1 |
cattattgatctggatagatcgagaaagttatctggattggagcactctgacgtctaagatagtaagtgaccaaagagtgtgaggtttacgagttgagaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550743 |
cattattgatctggatagaccgagaaagttatctggattggagcactctgacgtataagatagtaagtgaccaaagagtgtgaggtttacgagttgagaa |
12550842 |
T |
|
| Q |
101 |
attgtgtaccttgcattgttgtgagaaggattatttatacaatcctagaaaggagctgttgatgcgtaaagggaggaacgttacatatgacacccttcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550843 |
attgtgtaccttgcattgttgtgagaaagagtatttatacaatcctagaaaggagctgttgatgcgtaaagggaggaacgttacatatgacacccttcat |
12550942 |
T |
|
| Q |
201 |
taatggtgtgctcttgcagccgttcaaggtcattgaactcgttgaggcgttacaaatttcaagaatcttatgccaggtggattggt |
286 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550943 |
taatggtgtgctcttgcagccgttcgagggcattgaactcgttgaggcgttacaaatttcaagaatcttatgccaggtggattggt |
12551028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University